# Codon Usage Optimization AI Agent Connect

> Optimize DNA sequences for heterologous expression in specific hosts.

## Overview
- **Category:** genetics
- **Price:** Free
- **Endpoint:** https://edge.vinkius.com/vk_preview_EwhIYVMAwkqiTjDiRdWlLHasxz10yWoao2pKz7gf/ai-agent-connect
- **Tags:** dna, codon-optimization, biotechnology, genomics, protein-expression

## Description

This MCP server provides specialized tools for genetic engineering and synthetic biology. It allows users to transform protein sequences into optimized DNA sequences tailored for specific expression hosts like E. coli or H. sapiens. Use `optimize_sequence` to generate DNA with high CAI, `analyze_codon_usage` to profile sequence bias, `calculate_complexity_metrics` for structural analysis, and `validate_host_compatibility` to predict translation success.

## Tools

### analyze_codon_usage
Provides a statistical profile of the codon usage of a DNA sequence relative to a host

### calculate_complexity_metrics
Evaluates the physical and structural properties of a DNA sequence

### optimize_sequence
Generates an optimized DNA sequence for a given protein sequence based on a specific expression host

### validate_host_compatibility
Checks if a specific protein sequence is likely to be compatible with a host's translation machinery

## Prompt Examples

**Prompt:** 
```
Optimize this protein sequence for E. coli: MKWVTFISLLFLFSSAYSRGVFRR
```

**Response:** 
```
ATGAAATACAAAGTG... [optimized DNA sequence]
```

**Prompt:** 
```
What is the GC content of this DNA sequence: ATGCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
```

**Response:** 
```
The GC content for the provided sequence is 50.0%.
```

**Prompt:** 
```
Check if this protein is compatible with S. cerevisiae: MKTLLILTAVV
```

**Response:** 
```
The compatibility score for S. cerevisiae is 0.85, with low risk of translation stalling.
```

## Frequently Asked Questions

**How does the optimization process work?**
The server uses codon usage bias data to select synonymous codons that maximize the Codon Adaptation Index (CAI) for your chosen host.

**Can I avoid specific restriction sites?**
Yes, when using `optimize_sequence`, you can set the avoidRestrictionSites parameter to true to minimize common enzyme recognition sites.

**What hosts are supported?**
The server supports a wide range of hosts including E. coli, S. cerevisiae, and H. sapiens.