# CRISPR Guide Designer AI Agent Connect

> Design optimal CRISPR guide RNAs by analyzing PAM sites, efficiency, and off-target risks.

## Overview
- **Category:** genetics
- **Price:** Free
- **Endpoint:** https://edge.vinkius.com/vk_preview_VlGBGtl1tMVsdOTySGobGcVYXHeyJJjUv3y6m1sK/ai-agent-connect
- **Tags:** crispr, genome-editing, dna, rna, biotech

## Description

This MCP server provides a specialized toolset for CRISPR-Cas9 genome editing design. It allows AI agents to identify valid PAM sites using `find_pam_sites`, generate candidate sequences with `design_grna_sequences`, predict effectiveness via `evaluate_on_target_efficiency`, and mitigate unintended cleavage risks with `assess_off_target_risk`. It is designed to help researchers balance high on-target efficiency with minimal off-target effects.

## Tools

### assess_off_target_risk
Predicts the danger of unintended cleavage by searching the genome for similar sequences

### design_grna_sequences
Generates candidate guide RNA sequences based on identified target locations and PAM sites

### evaluate_on_target_efficiency
Calculates the predicted effectiveness of specific guide sequences at their intended target

### find_pam_sites
g., "NGG").

Identifies all valid locations within a target gene where a PAM sequence exists to allow Cas9 binding

## Prompt Examples

**Prompt:** 
```
Find all NGG PAM sites in the sequence ATGCGGATGCGG.
```

**Response:** 
```
Found PAM sites at positions 4 and 10 with sequence NGG.
```

**Prompt:** 
```
Design gRNA sequences for the target sequence GCTAGCTAGCTAGCTAGCTA with PAM sites at 5 and 15.
```

**Response:** 
```
Generated 2 candidate guides: GCTAGCTAGCTAGCTAGCTAG (pos 5, score 0.85) and TAGCTAGCTAGCTAGCTAGC (pos 15, score 0.78).
```

**Prompt:** 
```
What is the off-target risk for the guide sequence GCTAGCTAGCTAGCTAGCTA in the provided genome?
```

**Response:** 
```
The risk profile shows 0 potential off-target sites with significant mismatch counts in the seed region.
```

## Frequently Asked Questions

**How do I identify valid target locations?**
You can use the `find_pam_sites` tool by providing the target DNA sequence and the required PAM motif, such as NGG.

**Can I check for off-target risks?**
Yes, the `assess_off_target_risk` tool predicts the danger of unintended cleavage by searching the provided genome reference for similar sequences.

**How is guide efficiency calculated?**
The `evaluate_on_target_efficiency` tool calculates scores based on nucleotide composition and the position of nucleotides relative to the PAM.